ID: 1111646687_1111646690

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1111646687 1111646690
Species Human (GRCh38) Human (GRCh38)
Location 13:91040371-91040393 13:91040421-91040443
Sequence CCCATTCTCTTCAAGATGAGCAG AGAAAACACCACATATGACCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!