|
Left Crispr |
Right Crispr |
| Crispr ID |
1111722150 |
1111722154 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:91959457-91959479
|
13:91959500-91959522
|
| Sequence |
CCAAACTATCAAAGAAGAACTAA |
TTCCAAAAACATGAGGAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 9, 2: 73, 3: 514, 4: 1316} |
{0: 1, 1: 17, 2: 250, 3: 667, 4: 1596} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|