ID: 1111761203_1111761206

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1111761203 1111761206
Species Human (GRCh38) Human (GRCh38)
Location 13:92467652-92467674 13:92467692-92467714
Sequence CCTAAAACTAGCATGTAAAAGAG GAGTCGTATTTTTAACTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 305} {0: 1, 1: 0, 2: 0, 3: 4, 4: 91}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!