|
Left Crispr |
Right Crispr |
| Crispr ID |
1111844928 |
1111844935 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
13:93496116-93496138
|
13:93496163-93496185
|
| Sequence |
CCCCAGCCTTGCTGCCTCCTTGC |
AGCAATCAGCGAGAGTCCGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 431, 2: 2157, 3: 2093, 4: 1624} |
{0: 2, 1: 1411, 2: 1145, 3: 878, 4: 937} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|