|
Left Crispr |
Right Crispr |
Crispr ID |
1111844928 |
1111844936 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
13:93496116-93496138
|
13:93496169-93496191
|
Sequence |
CCCCAGCCTTGCTGCCTCCTTGC |
CAGCGAGAGTCCGTGGGCGTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 9, 1: 431, 2: 2157, 3: 2093, 4: 1624} |
{0: 2, 1: 1065, 2: 989, 3: 833, 4: 1027} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|