ID: 1111844930_1111844935

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1111844930 1111844935
Species Human (GRCh38) Human (GRCh38)
Location 13:93496118-93496140 13:93496163-93496185
Sequence CCAGCCTTGCTGCCTCCTTGCAG AGCAATCAGCGAGAGTCCGTGGG
Strand - +
Off-target summary {0: 12, 1: 424, 2: 2155, 3: 2012, 4: 1426} {0: 2, 1: 1411, 2: 1145, 3: 878, 4: 937}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!