ID: 1111844933_1111844936

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1111844933 1111844936
Species Human (GRCh38) Human (GRCh38)
Location 13:93496133-93496155 13:93496169-93496191
Sequence CCTTGCAGTTTGATCTCAGACTG CAGCGAGAGTCCGTGGGCGTAGG
Strand - +
Off-target summary {0: 3663, 1: 1439, 2: 732, 3: 491, 4: 588} {0: 2, 1: 1065, 2: 989, 3: 833, 4: 1027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!