ID: 1111861916_1111861918

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1111861916 1111861918
Species Human (GRCh38) Human (GRCh38)
Location 13:93718392-93718414 13:93718426-93718448
Sequence CCTAAATGTCTTCTTTTGAAAAG ATCCTTCGCCTACTTTTGATGGG
Strand - +
Off-target summary {0: 9, 1: 86, 2: 91, 3: 198, 4: 918} {0: 4, 1: 7, 2: 90, 3: 376, 4: 3142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!