ID: 1112039678_1112039680

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1112039678 1112039680
Species Human (GRCh38) Human (GRCh38)
Location 13:95534256-95534278 13:95534297-95534319
Sequence CCTTCAAATAGGAAAGAAAAAGA AACCATATGAAGCTACTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 176, 4: 1792} {0: 1, 1: 0, 2: 1, 3: 12, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!