ID: 1112142964_1112142975

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1112142964 1112142975
Species Human (GRCh38) Human (GRCh38)
Location 13:96666269-96666291 13:96666288-96666310
Sequence CCTTCCACCAGGTCCCTCTGATG GATGACATGGGGGGATTATAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 91, 3: 647, 4: 2214} {0: 1, 1: 0, 2: 2, 3: 62, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!