ID: 1112281499_1112281502

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1112281499 1112281502
Species Human (GRCh38) Human (GRCh38)
Location 13:98066601-98066623 13:98066630-98066652
Sequence CCAAATCTCATCTTGAATGGTAG TAATTCCCACACATTGTGAGAGG
Strand - +
Off-target summary {0: 46, 1: 4190, 2: 7375, 3: 9030, 4: 9223} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!