ID: 1112415506_1112415514

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1112415506 1112415514
Species Human (GRCh38) Human (GRCh38)
Location 13:99200732-99200754 13:99200765-99200787
Sequence CCCAGCGGGCGCACGCCCCTGAC CCGGGTGCGCCGTTCGTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50} {0: 1, 1: 0, 2: 0, 3: 0, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!