ID: 1112415512_1112415517

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1112415512 1112415517
Species Human (GRCh38) Human (GRCh38)
Location 13:99200749-99200771 13:99200780-99200802
Sequence CCTGACTGCGCATGCGCCGGGTG GTCAGCGGCGAGTGGCCTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 52} {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!