ID: 1112507468_1112507469

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1112507468 1112507469
Species Human (GRCh38) Human (GRCh38)
Location 13:99983568-99983590 13:99983582-99983604
Sequence CCACTTCTTTTACTCGGGGTCCA CGGGGTCCAAACGCCCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71} {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!