ID: 1112763191_1112763199

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1112763191 1112763199
Species Human (GRCh38) Human (GRCh38)
Location 13:102713355-102713377 13:102713404-102713426
Sequence CCTCTCGAGTAACTGGGATTACA TTTTGTGTTTTTAGTGAAGACGG
Strand - +
Off-target summary {0: 66, 1: 3705, 2: 62458, 3: 231908, 4: 259230} {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!