ID: 1112763194_1112763199

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1112763194 1112763199
Species Human (GRCh38) Human (GRCh38)
Location 13:102713382-102713404 13:102713404-102713426
Sequence CCTGCCACCACGCCCGGCTAATT TTTTGTGTTTTTAGTGAAGACGG
Strand - +
Off-target summary {0: 14909, 1: 57339, 2: 82932, 3: 69005, 4: 37700} {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!