ID: 1112806758_1112806762

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1112806758 1112806762
Species Human (GRCh38) Human (GRCh38)
Location 13:103171470-103171492 13:103171501-103171523
Sequence CCTAGGTGAATCTGATAAAGGTG GAGCTCTGTGTGTTGCCTCTCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!