ID: 1113239334_1113239337

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1113239334 1113239337
Species Human (GRCh38) Human (GRCh38)
Location 13:108318872-108318894 13:108318916-108318938
Sequence CCTTTTCTCCTCAATCTCACCAG TTAGTAATAGCCTTTCTGACTGG
Strand - +
Off-target summary No data {0: 11, 1: 490, 2: 2079, 3: 4186, 4: 5622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!