ID: 1113286463_1113286471

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1113286463 1113286471
Species Human (GRCh38) Human (GRCh38)
Location 13:108854241-108854263 13:108854269-108854291
Sequence CCCACCACAGTCTCCCTGTGCTG ACAGGTGTAAGCCACCACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 99, 4: 889} {0: 9, 1: 216, 2: 1069, 3: 3246, 4: 6470}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!