ID: 1113393365_1113393369

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113393365 1113393369
Species Human (GRCh38) Human (GRCh38)
Location 13:109919301-109919323 13:109919350-109919372
Sequence CCTGACACACAAGTCAAAAAGAG CAACTGTAATCCCAGCACTCTGG
Strand - +
Off-target summary No data {0: 27, 1: 3104, 2: 83654, 3: 219372, 4: 256591}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!