ID: 1113393365_1113393371

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1113393365 1113393371
Species Human (GRCh38) Human (GRCh38)
Location 13:109919301-109919323 13:109919354-109919376
Sequence CCTGACACACAAGTCAAAAAGAG TGTAATCCCAGCACTCTGGGAGG
Strand - +
Off-target summary No data {0: 7837, 1: 299856, 2: 263617, 3: 151465, 4: 134888}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!