ID: 1113479481_1113479489

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1113479481 1113479489
Species Human (GRCh38) Human (GRCh38)
Location 13:110610022-110610044 13:110610074-110610096
Sequence CCCCCGGCATCAATATGGGACAA TGGCATACCTTTACAAAAAGCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!