ID: 1113529219_1113529223

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113529219 1113529223
Species Human (GRCh38) Human (GRCh38)
Location 13:111008194-111008216 13:111008230-111008252
Sequence CCTGGGAATTTAACCATGTCAGT CATTATTAACTGGGAAAAAATGG
Strand - +
Off-target summary {0: 11, 1: 59, 2: 138, 3: 144, 4: 244} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!