ID: 1113568862_1113568870

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1113568862 1113568870
Species Human (GRCh38) Human (GRCh38)
Location 13:111339244-111339266 13:111339293-111339315
Sequence CCCAGTCAAGGATTTGTCTATGA GTTTAGGGGAGGAATTGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 139} {0: 1, 1: 0, 2: 1, 3: 16, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!