ID: 1113629858_1113629860

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1113629858 1113629860
Species Human (GRCh38) Human (GRCh38)
Location 13:111874758-111874780 13:111874794-111874816
Sequence CCATTGTCCATTGGTATATTTAG AAATATAGACAATGAGACCAAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 73, 4: 269} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!