ID: 1113665323_1113665325

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1113665323 1113665325
Species Human (GRCh38) Human (GRCh38)
Location 13:112137004-112137026 13:112137050-112137072
Sequence CCTCAGAGGCTTTAGGTCTCTGA CAGCTCCAGCATGCTGAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!