ID: 1113710564_1113710575

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1113710564 1113710575
Species Human (GRCh38) Human (GRCh38)
Location 13:112461757-112461779 13:112461808-112461830
Sequence CCTGCAGAGAGACAGGGAAGCAG CGAAGCCTGCTGCAGTCTAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!