ID: 1113909257_1113909277

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1113909257 1113909277
Species Human (GRCh38) Human (GRCh38)
Location 13:113834482-113834504 13:113834519-113834541
Sequence CCGAAAGCCCCCACCGGCGAGGG GTGAAGGGCCCGCGGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93} {0: 1, 1: 0, 2: 1, 3: 16, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!