ID: 1113984555_1113984561

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1113984555 1113984561
Species Human (GRCh38) Human (GRCh38)
Location 13:114303452-114303474 13:114303483-114303505
Sequence CCATGCTCCATCTGTGTATACAG CTGGTAAGAAGCAGAATTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 200} {0: 1, 1: 0, 2: 4, 3: 23, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!