ID: 1114110421_1114110423

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1114110421 1114110423
Species Human (GRCh38) Human (GRCh38)
Location 14:19472459-19472481 14:19472474-19472496
Sequence CCAACTGGTCTTTGACAAAGCAA CAAAGCAAACAATATAAAGTGGG
Strand - +
Off-target summary {0: 22, 1: 424, 2: 708, 3: 1108, 4: 2105} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!