ID: 1114167608_1114167613

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1114167608 1114167613
Species Human (GRCh38) Human (GRCh38)
Location 14:20235880-20235902 14:20235927-20235949
Sequence CCTCGCTGCCGCCTTGCAGTTTG CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 1083, 1: 2030, 2: 1615, 3: 820, 4: 595} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!