ID: 1114167610_1114167613

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1114167610 1114167613
Species Human (GRCh38) Human (GRCh38)
Location 14:20235891-20235913 14:20235927-20235949
Sequence CCTTGCAGTTTGATCACAGACTG CAGCGAGACACCGTGGGCGTAGG
Strand - +
Off-target summary {0: 20, 1: 3687, 2: 1421, 3: 733, 4: 657} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!