ID: 1114221923_1114221931

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1114221923 1114221931
Species Human (GRCh38) Human (GRCh38)
Location 14:20704412-20704434 14:20704456-20704478
Sequence CCGCTTCCACACTAGCACTCCCC TTACACACAGCTGAAATACAAGG
Strand - +
Off-target summary No data {0: 10, 1: 9, 2: 82, 3: 146, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!