ID: 1114476446_1114476454

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1114476446 1114476454
Species Human (GRCh38) Human (GRCh38)
Location 14:22998537-22998559 14:22998583-22998605
Sequence CCAGCTGCCGCAGCTCCTCAATC GCTGTCACACTCCTCTTCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 286} {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!