ID: 1114770212_1114770218

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1114770212 1114770218
Species Human (GRCh38) Human (GRCh38)
Location 14:25422155-25422177 14:25422171-25422193
Sequence CCCTCTGGCCTCAGCCTTCGAAG TTCGAAGTAGCTGGGACTACAGG
Strand - +
Off-target summary No data {0: 14, 1: 1992, 2: 56139, 3: 224674, 4: 287410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!