ID: 1114770212_1114770219

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1114770212 1114770219
Species Human (GRCh38) Human (GRCh38)
Location 14:25422155-25422177 14:25422190-25422212
Sequence CCCTCTGGCCTCAGCCTTCGAAG CAGGCATGTACCACCATGCCTGG
Strand - +
Off-target summary No data {0: 535, 1: 11266, 2: 39330, 3: 91139, 4: 160448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!