ID: 1114921773_1114921778

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1114921773 1114921778
Species Human (GRCh38) Human (GRCh38)
Location 14:27341802-27341824 14:27341826-27341848
Sequence CCTCACCCAAATCTCACCTTGAA TGTAATAATCCCCATGTGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 10, 2: 17, 3: 72, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!