ID: 1115085738_1115085747

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1115085738 1115085747
Species Human (GRCh38) Human (GRCh38)
Location 14:29512969-29512991 14:29513014-29513036
Sequence CCCCTGTGGCTTTGCAGGGTACA AGGCTGGAGTTGAGTGTCCTTGG
Strand - +
Off-target summary {0: 907, 1: 1362, 2: 1353, 3: 919, 4: 764} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!