ID: 1115085740_1115085748

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1115085740 1115085748
Species Human (GRCh38) Human (GRCh38)
Location 14:29512971-29512993 14:29513024-29513046
Sequence CCTGTGGCTTTGCAGGGTACAGC TGAGTGTCCTTGGCTTTTCCAGG
Strand - +
Off-target summary {0: 835, 1: 1480, 2: 1472, 3: 1176, 4: 922} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!