ID: 1115085743_1115085747

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1115085743 1115085747
Species Human (GRCh38) Human (GRCh38)
Location 14:29512996-29513018 14:29513014-29513036
Sequence CCCTCCAGCTGCTTTCACAGGCT AGGCTGGAGTTGAGTGTCCTTGG
Strand - +
Off-target summary {0: 13, 1: 148, 2: 350, 3: 780, 4: 1200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!