|
Left Crispr |
Right Crispr |
| Crispr ID |
1115279675 |
1115279676 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:31647575-31647597
|
14:31647591-31647613
|
| Sequence |
CCTACAATGTGGTGCTGCTGAAC |
GCTGAACAGTCAGTCTGATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 11, 2: 26, 3: 43, 4: 151} |
{0: 2, 1: 7, 2: 35, 3: 81, 4: 145} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|