ID: 1115463078_1115463079

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1115463078 1115463079
Species Human (GRCh38) Human (GRCh38)
Location 14:33683907-33683929 14:33683926-33683948
Sequence CCACTAATTACAGGAGTTAATTC ATTCACACCACATCCCTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 239} {0: 1, 1: 0, 2: 4, 3: 43, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!