ID: 1115754706_1115754711

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1115754706 1115754711
Species Human (GRCh38) Human (GRCh38)
Location 14:36519518-36519540 14:36519550-36519572
Sequence CCTTAATTGGCTTGAGTGGAGGC GCCTCGCGTTTGTTTTAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85} {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!