ID: 1115772731_1115772739

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1115772731 1115772739
Species Human (GRCh38) Human (GRCh38)
Location 14:36683216-36683238 14:36683253-36683275
Sequence CCGATTCTCCCTGTGGGAATGGC TGGGTAGGCGTCCTGAAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 190} {0: 1, 1: 0, 2: 1, 3: 8, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!