ID: 1115772734_1115772737

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1115772734 1115772737
Species Human (GRCh38) Human (GRCh38)
Location 14:36683225-36683247 14:36683238-36683260
Sequence CCTGTGGGAATGGCAGCCGGTTT CAGCCGGTTTTTTTGTGGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 88} {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!