ID: 1115903726_1115903731

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1115903726 1115903731
Species Human (GRCh38) Human (GRCh38)
Location 14:38183900-38183922 14:38183936-38183958
Sequence CCATGTGATTTAGAGAGGGGGTT TGTAAGCTAGATCTCTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128} {0: 1, 1: 0, 2: 1, 3: 7, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!