ID: 1116058660_1116058664

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1116058660 1116058664
Species Human (GRCh38) Human (GRCh38)
Location 14:39895029-39895051 14:39895060-39895082
Sequence CCTGCATCTTTGAAGAGCCCTGT TTCTCTGTATGTTGGATCTAAGG
Strand - +
Off-target summary {0: 118, 1: 138, 2: 123, 3: 118, 4: 251} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!