ID: 1116126614_1116126622

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1116126614 1116126622
Species Human (GRCh38) Human (GRCh38)
Location 14:40796633-40796655 14:40796660-40796682
Sequence CCTGGTCCAGCAAACAATTTTCC CTAGGCCTCTGGGCCTGTGATGG
Strand - +
Off-target summary No data {0: 409, 1: 951, 2: 1423, 3: 1536, 4: 1376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!