ID: 1116147844_1116147848

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1116147844 1116147848
Species Human (GRCh38) Human (GRCh38)
Location 14:41098948-41098970 14:41098975-41098997
Sequence CCTAGAGACTTGTTAAATGGCTT CAAAATGCTGATAGCAATATGGG
Strand - +
Off-target summary {0: 70, 1: 1596, 2: 1945, 3: 1425, 4: 1020} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!