ID: 1116677411_1116677415

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1116677411 1116677415
Species Human (GRCh38) Human (GRCh38)
Location 14:47923604-47923626 14:47923623-47923645
Sequence CCCTTTGCACCACACCAGAATTC ATTCATTATTGCCTGTCTTTTGG
Strand - +
Off-target summary No data {0: 56, 1: 135, 2: 736, 3: 977, 4: 1029}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!